Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms
Regulation of the neuronal transcription factor NPAS4 by REST and microRNAs
Graphical abstract
Introduction
Neuronal activity dependent transcription is critical for the development and maintenance of synapses in the developing central nervous system [1], [2]. This process is reliant upon calcium influx through voltage gated calcium channels, which stimulates the expression of intermediate early genes, in turn modulating downstream synapse effectors [3], [4]. These mechanisms are active during development and throughout adulthood, and are thought to underlie memory and learning [5], [6]. The homeostatic balance between excitatory and inhibitory inputs during these development and maintenance periods is also thought to be an important contributor to neuropsychiatric disease [7], [8]. Indeed it has been recently demonstrated that optogenetic disruption of the excitatory/inhibitory balance in mice can lead to social dysfunction [9], [10].
NPAS4 (Neuronal Per-ARNT-SIM homology domain 4) is a bHLH/PAS (basic Helix-Loop-Helix/Per-Arnt-Sim) transcription factor that is highly restricted to the central nervous system and specifically coupled to calcium influx following neuronal activity [11], [12], [13], [14], [15]. NPAS4 mRNA can be stimulated by a number of stressors, including ischemia and seizure, as well as physiological inducers such as light, odor or paradigms of memory formation in mice [11], [12], [15], [16], [17], [18]. In addition, NPAS4 expression appears to be developmentally controlled, being induced around birth and predominantly restricted to cortical and hippocampal areas of the rodent brain [12], [19]. Increased NPAS4 mRNA following excitatory synapse activation leads to rapid, transient protein expression which in turn activates a number of genes involved in the formation of inhibitory synapses [11], [12]. NPAS4 increases the number of GABA-releasing synapses following neuron activation to maintain activity homeostasis, i.e. the excitatory/inhibitory balance in neurons. Consequently, NPAS4 null mice are hyperactive, prone to seizures and exhibit a number of defects in social interaction and memory formation [11], [12], [16]. Therefore the precise spatial and temporal expression of NPAS4 is a likely determinate in regulating proper synapse formation and maintenance both during development and in response to neuronal activity. Here we identify mechanisms which restrict NPAS4 expression to the CNS. We show that the transcription repressor REST inhibits NPAS4 expression in non-neuronal and undifferentiated cells. Furthermore, we show that NPAS4 expression can be modulated by miR-224, which is expressed from an intron of the GABAA receptor epsilon gene and is enriched in the midbrain/hypothalamus region of the mouse CNS. Conversely expression of NPAS4 is high within the cortex and low within the midbrain/hypothalamus, suggesting miR-224 may play a role in regionalizing NPAS4 expression in vivo.
Section snippets
Generation of DNA constructs
All DNA constructs generated by PCR were amplified using Phusion High-Fidelity DNA polymerase (New England Biosciences) and sequence verified. To create pEFIRESpuro-NPAS4-2Myc, mouse NPAS4 cDNA was PCR amplified using mNPAS4 XhoI F 5′ CCGCTCGAGGTCATGTACCGATCCACC 3′ and mNPAS4 SmaI R 5′ GTCCCCCGGGAAACGTTGGTTCCCCTC 3′ and cloned into XhoI/SmaI digested pEFIRESpuro-SIM2-2Myc [20]. pCI-6xmyc-REST (a gift from David Anderson) was subcloned into pENTR1a (Invitrogen) using BamHI/XbaI and 6xMyc-REST
NPAS4 expression is temporally and spatially restricted
NPAS4 expression has been previously shown to be restricted to the central nervous system in rodents and dramatically increased upon KCl-induced depolarization in cultured neurons [11], [12], [15], [30]. To further investigate developmental and depolarisation induced expression, NPAS4 mRNA was compared in mouse embryonic stem cells, primary cortical neurons and regional areas of brain tissue. NPAS4 was barely detectable in pluripotent embryonic stem cells, but readily expressed in unstimulated
Discussion
NPAS4 is a critical player in neuronal activity homeostasis and not surprisingly its expression is tightly regulated (Fig. 1) [11], [12]. The spatiotemporal expression of NPAS4 is characterized by precise restriction to the CNS and tight transient induction following neuronal activity or various forms of physiological and pathological stress [11], [12], [13], [15], [45]. The mechanisms underlying this restriction to CNS and transient response to stressors have been previously unknown. Here we
Funding
This research was supported by the Australian Research Council.
Acknowledgements
We would like to thank Dr. N. Ooe (Sumitomo Chemical), Dr. A.S. Yoo (Washington University), Prof. G.R. Crabtree (Stanford University) and Prof. D. Anderson (California Institute of Technology) for providing reagents/DNA clones.
References (61)
- et al.
Characterization of Drosophila and Caenorhabditis elegans NXF-like-factors, putative homologs of mammalian NXF
Gene
(2007) - et al.
LE-PAS, a novel Arnt-dependent HLH-PAS protein, is expressed in limbic tissues and transactivates the CNS midline enhancer element
Brain Res. Mol. Brain Res.
(2004) - et al.
Differential activities of murine single minded 1 (SIM1) and SIM2 on a hypoxic response element. Cross-talk between basic helix-loop-helix/per-Arnt-Sim homology transcription factors
J. Biol. Chem.
(2002) - et al.
REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis
Cell
(2005) - et al.
Characterization of functional heterodimer partners in brain for a bHLH-PAS factor NXF
Biochim. Biophys. Acta
(2009) - et al.
The many faces of REST oversee epigenetic programming of neuronal genes
Curr. Opin. Neurobiol.
(2005) - et al.
No rest for REST: REST/NRSF regulation of neurogenesis
Cell
(2005) - et al.
REST acts through multiple deacetylase complexes
Neuron
(2001) - et al.
Regulation of neuronal traits by a novel transcriptional complex
Neuron
(2001) - et al.
REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons
Cell
(1995)